About this Flowcell
Flowcell: AAH2CNTM5
Instrument:
NextSeq2000
(Tardigrade)
Instrument Model: Illumina NextSeq2000
Instrument Model: Illumina NextSeq2000
Type: Paired
Read Length: 300
Control Lane: None
Notes:
P1 600 cycles. 301-12-301 550 pM. 15% PhiX. XLEAP-SBS Add 550 ul of R1/R2 primers to custom well 1 of NextSeq cartridge Add 550 ul of I1 primer to custom well 2 of NextSeq cartridge Nextera Read 1 Primer (Igor, IDT) at 100 uM: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Genomic DNA Sequencing Primer (Igor, IDT) at 100 uM: ACACTCTTTCCCTACACGACGCTCTTCCGATCT Nextera Read2 Primer (IDT, not HPLC-purified, provided by Matt but designed by Igor) at 100 uM: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG Genomic DNA Read2 Sequencing Primer (IDT, not HPLC-purified, provided by Matt but designed by Igor) at 100 uM: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 16S Read 1 primer priovided by Matt at 100 uM 16S Read 2 primer priovided by Matt at 100 uM 16S Indices primer priovided by Matt at 100 uM
About this lane
Lane: 1pM: 5.00
Library Name
Library ID: 27627Name: 20250518_16S_DARPA_Final_Pool
Affiliations:
- Matt Cooper ( Ismagilov )
Library Details
Library Type: Other MultiplexingMultiplex Index: Err: id empty
Creation Date May 28, 2025
Made By: Matt Cooper
Gel Cut Size: 354
Concentration: 1.95 ng/µl
Protocol Stopping Point Completed